shtomosyn vector  (Addgene inc)

Journal: Journal of Neuroscience Research

Article Title: Tomosyn regulates the small RhoA GTPase to control the dendritic stability of neurons and the surface expression of AMPA receptors

doi: 10.1002/jnr.24608

Figure Lengend Snippet: Knockdown of tomosyn reduces dendritic complexity and dendritic spine density. (a) Representative images and reconstructed dendritic trees from mouse hippocampal neurons transfected with scrambled shRNA + GFP or shTomosyn + GFP or shTomosyn + Tom r ‐GFP. Scale bar, 100 µm. (b) Sholl analysis, (c) branch number, and (d) total dendrite length of reconstructed neurons. General dendrite complexity was quantified by the area under the Sholl curve. Neurons expressing shTomosyn exhibited compromised dendritic complexity, whereas expression of Tom r ‐GFP rescued simplified dendritic complexity in shTomosyn‐expressing neurons compared to scramble controls. * p < 0.05, **** p < 0.0001, one‐way ANOVA with Tukey's test. n = 26 scramble, 28 shTomosyn, and 27 Tomosyn rescue. (e) Confocal images of dendritic spines from neurons transfected with scrambled shRNA + GFP, shTomosyn + GFP, or shTomosyn + Tom r ‐GFP for 72 hr. Scale bar, 2 µm. (f) Mean spine density was decreased in tomosyn knockdown neurons at primary, secondary, and tertiary dendrites. Spine density was restored in Tom r ‐GFP rescue and shTomosyn co‐expressing neurons compared to shTomosyn + GFP. * p < 0.05, *** p < 0.001, **** p < 0.0001 by two‐way ANOVA with Tukey's test multiple comparisons test. n = 15 scramble, 14 shTomosyn, and 15 Tomosyn rescue [Color figure can be viewed at https://www.wileyonlinelibrary.com ]

Article Snippet: The shRNA‐resistant tomosyn (wild‐type WT r ‐Tom‐GFP, L412V r ‐Tom‐GFP, and Y502C r ‐Tom‐GFP) constructs were made by mutating three nucleotides in the shTomosyn sequences with two PCR primers: Forward 5′‐AGTGGCTCTATGTGGGCACGGAACGCGGAAACATACACATTGTTA‐3′ and Reverse 5′‐TAACAATGTGTATGTTTCCGCGTTCCGTGCCCACATAGAGCCACT‐3′. shTomosyn‐WT r ‐Tom‐RFP, shTomosyn‐L412V r ‐Tom‐RFP, and shTomosyn‐Y502C r ‐Tom‐RFP were generated by inserting WT r ‐Tom, L412V r ‐Tom, or Y502C r ‐Tom into the shTomosyn vector. pcDNA3‐EGFP‐RhoA‐WT (Addgene, plasmid # 12965) and pcDNA3‐EGFP‐RhoA‐T19N (Addgene, plasmid # 12967) were gifts from Gary Bokoch (Subauste et al., ). pCI‐SEP‐GluR1 (Addgene, plasmid #24000) was a gift from Robert Malinow (Kopec, Li, Wei, Boehm, & Malinow, ). pTriEx‐RhoA FLARE.sc Biosensor WT (Addgene, plasmid # 12150) was a gift from Klaus Hahn (Pertz, Hodgson, Klemke, & Hahn, ). pCAGIG (IRES‐GFP; Addgene, plasmid # 11159) was a gift from Connie Cepko (Matsuda & Cepko, ). pRFP‐N1 was constructed by replacing GFP in the pEGFP‐N1 (Clontech, Catalog # 6085‐1) with RFP.

Techniques: Knockdown, Transfection, shRNA, Expressing

Journal: Journal of Neuroscience Research

Article Title: Tomosyn regulates the small RhoA GTPase to control the dendritic stability of neurons and the surface expression of AMPA receptors

doi: 10.1002/jnr.24608

Figure Lengend Snippet: Frequency of miniature EPSCs is decreased in tomosyn knockdown neurons. Cultured hippocampal neurons were transfected with either scrambled shRNA or shTomosyn. (a) An example of current traces collected from whole‐cell voltage‐clamp of hippocampal neurons. (b) Examples of average (top) and scaled (bottom) mEPSC traces from scrambled shRNA and shTomosyn transfected neurons. Summary graphs show (c) frequency, (d) amplitude, (e) charge, and (f) decay time constant of recorded mEPSCs. * p < 0.05, **** p < 0.0001, Student's t‐ test. n = 22 scramble and 21 shTomosyn [Color figure can be viewed at https://www.wileyonlinelibrary.com ]

Article Snippet: The shRNA‐resistant tomosyn (wild‐type WT r ‐Tom‐GFP, L412V r ‐Tom‐GFP, and Y502C r ‐Tom‐GFP) constructs were made by mutating three nucleotides in the shTomosyn sequences with two PCR primers: Forward 5′‐AGTGGCTCTATGTGGGCACGGAACGCGGAAACATACACATTGTTA‐3′ and Reverse 5′‐TAACAATGTGTATGTTTCCGCGTTCCGTGCCCACATAGAGCCACT‐3′. shTomosyn‐WT r ‐Tom‐RFP, shTomosyn‐L412V r ‐Tom‐RFP, and shTomosyn‐Y502C r ‐Tom‐RFP were generated by inserting WT r ‐Tom, L412V r ‐Tom, or Y502C r ‐Tom into the shTomosyn vector. pcDNA3‐EGFP‐RhoA‐WT (Addgene, plasmid # 12965) and pcDNA3‐EGFP‐RhoA‐T19N (Addgene, plasmid # 12967) were gifts from Gary Bokoch (Subauste et al., ). pCI‐SEP‐GluR1 (Addgene, plasmid #24000) was a gift from Robert Malinow (Kopec, Li, Wei, Boehm, & Malinow, ). pTriEx‐RhoA FLARE.sc Biosensor WT (Addgene, plasmid # 12150) was a gift from Klaus Hahn (Pertz, Hodgson, Klemke, & Hahn, ). pCAGIG (IRES‐GFP; Addgene, plasmid # 11159) was a gift from Connie Cepko (Matsuda & Cepko, ). pRFP‐N1 was constructed by replacing GFP in the pEGFP‐N1 (Clontech, Catalog # 6085‐1) with RFP.

Techniques: Knockdown, Cell Culture, Transfection, shRNA

Journal: Journal of Neuroscience Research

Article Title: Tomosyn regulates the small RhoA GTPase to control the dendritic stability of neurons and the surface expression of AMPA receptors

doi: 10.1002/jnr.24608

Figure Lengend Snippet: Tomosyn knockdown results in increased RhoA activity in hippocampal neurons. Hippocampal neurons were co‐transfected with a RhoA biosensor and either scrambled shRNA or shTomosyn. (a) Representative images show the neurons in the intensity‐modulated display mode. Higher magnification of the soma and a dendritic segment in dashed box areas are enlarged for better visualization. Scale bar, 20 and 5 µm. (b) FRET efficiency was determined as a ratio of YFP/CFP. **** p < 0.0001, unpaired Student's t ‐test. n = 72 scramble and 69 shTomosyn. (c) Schematic structure of domain mutant tomosyn. FL‐Tom, full‐length mouse tomosyn (1‐1166 aa); Tom‐ΔC, containing an N‐terminal domain with WD40 repeats (1‐1048 aa); Tom‐ΔN, containing a SNARE coil‐coiled domain (1049‐1109 aa). (d) Western blot shows the expression of domain mutant tomosyn (Tom‐ΔC‐RFP and Tom‐ΔN‐RFP), FL‐Tom‐RFP, and RFP control in N2a cells. (e) Summary graph showing FRET efficiency in domain mutant tomosyn‐expressing neurons. Neurons with Tom‐ΔN‐RFP showed increased FRET efficiency. *** p < 0.001 compared to RFP, FL‐tomosyn, and ΔC‐tomosyn, one‐way ANOVA with Dunnett's multiple comparisons test. n = 32 RFP, 28 FL‐Tom‐RFP, 29 Tom‐ΔC‐RFP, and 32 Tom‐ΔN‐RFP

Article Snippet: The shRNA‐resistant tomosyn (wild‐type WT r ‐Tom‐GFP, L412V r ‐Tom‐GFP, and Y502C r ‐Tom‐GFP) constructs were made by mutating three nucleotides in the shTomosyn sequences with two PCR primers: Forward 5′‐AGTGGCTCTATGTGGGCACGGAACGCGGAAACATACACATTGTTA‐3′ and Reverse 5′‐TAACAATGTGTATGTTTCCGCGTTCCGTGCCCACATAGAGCCACT‐3′. shTomosyn‐WT r ‐Tom‐RFP, shTomosyn‐L412V r ‐Tom‐RFP, and shTomosyn‐Y502C r ‐Tom‐RFP were generated by inserting WT r ‐Tom, L412V r ‐Tom, or Y502C r ‐Tom into the shTomosyn vector. pcDNA3‐EGFP‐RhoA‐WT (Addgene, plasmid # 12965) and pcDNA3‐EGFP‐RhoA‐T19N (Addgene, plasmid # 12967) were gifts from Gary Bokoch (Subauste et al., ). pCI‐SEP‐GluR1 (Addgene, plasmid #24000) was a gift from Robert Malinow (Kopec, Li, Wei, Boehm, & Malinow, ). pTriEx‐RhoA FLARE.sc Biosensor WT (Addgene, plasmid # 12150) was a gift from Klaus Hahn (Pertz, Hodgson, Klemke, & Hahn, ). pCAGIG (IRES‐GFP; Addgene, plasmid # 11159) was a gift from Connie Cepko (Matsuda & Cepko, ). pRFP‐N1 was constructed by replacing GFP in the pEGFP‐N1 (Clontech, Catalog # 6085‐1) with RFP.

Techniques: Knockdown, Activity Assay, Transfection, shRNA, Mutagenesis, Western Blot, Expressing, Control

Journal: Journal of Neuroscience Research

Article Title: Tomosyn regulates the small RhoA GTPase to control the dendritic stability of neurons and the surface expression of AMPA receptors

doi: 10.1002/jnr.24608

Figure Lengend Snippet: Inhibition of the Rho signaling pathway restores altered dendritic structures in tomosyn knockdown neurons. Representative images show (a) dendritic morphology at DIV7 and (b) spine morphology at DIV15. Transfected neurons were co‐expressed by scramble shRNA or IRES‐EGFP together with IRES‐EGFP (left), EGFP‐WT‐RhoA (middle), and EGFP‐T19N‐RhoA (right). Scale bar, 100 µm in a and 2 µm in b. Quantification of (c) branch number, (d) total dendrite length, and (e) spine density of neurons co‐transfected neurons. Co‐expression of T19N‐RhoA resulted in similar levels of dendritic complexity and spine density between scramble control‐ and shTomosyn‐expressing neurons. ** p < 0.01, *** p < 0.001, **** p < 0.0001, two‐way ANOVA with Sidak's multiple comparisons test. n = 27 scramble + ctrl, 35 scramble + WT‐RhoA, 34 scramble + T19N‐RhoA, 37 shTomosyn + ctrl, 35 shTomosyn + WT‐RhoA, and 36 shTomosyn + T19N‐RhoA in c and d; n = 20 scramble + ctrl, 26 scramble + WT‐RhoA, 22 scramble + T19N‐RhoA, 18 shTomosyn + ctrl, 19 shTomosyn + WT‐RhoA, 21 shTomosyn + T19N‐RhoA in e

Article Snippet: The shRNA‐resistant tomosyn (wild‐type WT r ‐Tom‐GFP, L412V r ‐Tom‐GFP, and Y502C r ‐Tom‐GFP) constructs were made by mutating three nucleotides in the shTomosyn sequences with two PCR primers: Forward 5′‐AGTGGCTCTATGTGGGCACGGAACGCGGAAACATACACATTGTTA‐3′ and Reverse 5′‐TAACAATGTGTATGTTTCCGCGTTCCGTGCCCACATAGAGCCACT‐3′. shTomosyn‐WT r ‐Tom‐RFP, shTomosyn‐L412V r ‐Tom‐RFP, and shTomosyn‐Y502C r ‐Tom‐RFP were generated by inserting WT r ‐Tom, L412V r ‐Tom, or Y502C r ‐Tom into the shTomosyn vector. pcDNA3‐EGFP‐RhoA‐WT (Addgene, plasmid # 12965) and pcDNA3‐EGFP‐RhoA‐T19N (Addgene, plasmid # 12967) were gifts from Gary Bokoch (Subauste et al., ). pCI‐SEP‐GluR1 (Addgene, plasmid #24000) was a gift from Robert Malinow (Kopec, Li, Wei, Boehm, & Malinow, ). pTriEx‐RhoA FLARE.sc Biosensor WT (Addgene, plasmid # 12150) was a gift from Klaus Hahn (Pertz, Hodgson, Klemke, & Hahn, ). pCAGIG (IRES‐GFP; Addgene, plasmid # 11159) was a gift from Connie Cepko (Matsuda & Cepko, ). pRFP‐N1 was constructed by replacing GFP in the pEGFP‐N1 (Clontech, Catalog # 6085‐1) with RFP.

Techniques: Inhibition, Knockdown, Transfection, shRNA, Expressing, Control

Journal: Journal of Neuroscience Research

Article Title: Tomosyn regulates the small RhoA GTPase to control the dendritic stability of neurons and the surface expression of AMPA receptors

doi: 10.1002/jnr.24608

Figure Lengend Snippet: Surface expression of GluR1 subunits is reduced in tomosyn knockdown neurons. (a) Western blot analysis of co‐immunoprecipitation experiments in cultured cortical neurons. Cultured cortical neuron lysates at 15 DIV were immunoprecipitated with either anti‐tomosyn antibody, rabbit IgG control, anti‐syntaxin‐4 antibody, or mouse IgG control. Immunoblot was probed with tomosyn and syntaxin‐4 antibodies. FT = flow through. Quantification of the surface expression of pHluorin‐GluR1 in (b) dendritic spines and (c) dendritic segments. Cultured neurons were co‐transfected with either Tomosyn‐RFP (OE), scrambled shRNA, or shTomosyn and pHluorin‐GluR1. Tomosyn knockdown neurons were treated with the RhoA inhibitor, C3T. * p < 0.05, *** p < 0.001, one‐way ANOVA with Dunnett's multiple comparisons test. n = 16 OE, 20 scramble, 22 shTomosyn, and 23 shTomosyn + C3T. (d) Representative confocal images showing surface staining for pHluorin‐GluR1 in cultured hippocampal neurons at 15 DIV. Scale bar, 2 µm

Article Snippet: The shRNA‐resistant tomosyn (wild‐type WT r ‐Tom‐GFP, L412V r ‐Tom‐GFP, and Y502C r ‐Tom‐GFP) constructs were made by mutating three nucleotides in the shTomosyn sequences with two PCR primers: Forward 5′‐AGTGGCTCTATGTGGGCACGGAACGCGGAAACATACACATTGTTA‐3′ and Reverse 5′‐TAACAATGTGTATGTTTCCGCGTTCCGTGCCCACATAGAGCCACT‐3′. shTomosyn‐WT r ‐Tom‐RFP, shTomosyn‐L412V r ‐Tom‐RFP, and shTomosyn‐Y502C r ‐Tom‐RFP were generated by inserting WT r ‐Tom, L412V r ‐Tom, or Y502C r ‐Tom into the shTomosyn vector. pcDNA3‐EGFP‐RhoA‐WT (Addgene, plasmid # 12965) and pcDNA3‐EGFP‐RhoA‐T19N (Addgene, plasmid # 12967) were gifts from Gary Bokoch (Subauste et al., ). pCI‐SEP‐GluR1 (Addgene, plasmid #24000) was a gift from Robert Malinow (Kopec, Li, Wei, Boehm, & Malinow, ). pTriEx‐RhoA FLARE.sc Biosensor WT (Addgene, plasmid # 12150) was a gift from Klaus Hahn (Pertz, Hodgson, Klemke, & Hahn, ). pCAGIG (IRES‐GFP; Addgene, plasmid # 11159) was a gift from Connie Cepko (Matsuda & Cepko, ). pRFP‐N1 was constructed by replacing GFP in the pEGFP‐N1 (Clontech, Catalog # 6085‐1) with RFP.

Techniques: Expressing, Knockdown, Western Blot, Immunoprecipitation, Cell Culture, Control, Transfection, shRNA, Staining

Journal: Journal of Neuroscience Research

Article Title: Tomosyn regulates the small RhoA GTPase to control the dendritic stability of neurons and the surface expression of AMPA receptors

doi: 10.1002/jnr.24608

Figure Lengend Snippet: Autism‐associated mutant tomosyn fails to restore dendritic arborization and spine loss in tomosyn knockdown neurons. (a) An illustration of the location of L412V and Y502C mutations in tomosyn. (b) Representative images of reconstructed dendritic trees and (c) Sholl analysis, (d) branch number, and (e) total dendrite length from mouse hippocampal neurons transfected with scrambled shRNA + GFP, shTomosyn + GFP, shTomosyn + WT r ‐Tom‐GFP, shTomosyn + L412V r ‐Tom‐GFP, or shTomosyn + Y502C r ‐Tom‐GFP. Scale bar, 100 µm. Both L412V and Y502C mutant tomosyn failed to rescue total dendrite length compared to scrambled shRNA. Only Y502C failed to rescue branch number compared to scramble. # p < 0.05, ## p < 0.01, ### p < 0.001, #### p < 0.0001 when compared to scramble; * p < 0.05, ** p < 0.01, **** p < 0.0001 when compared to shTomosyn, one‐way ANOVA with Tukey multiple comparisons test. n = 30 scramble, 31 shTomosyn, 27 WT rescue, 33 L412V rescue, and 31 Y502C rescue. (f) Representative confocal images and (g) the quantification of spine density in cultured hippocampal neurons transfected with different tomosyn constructs as described in b, c, d, and e. Scale bar, 2 µm. #### p < 0.0001 when compared to scramble; **** p < 0.0001 when compared to shTomosyn, one‐way ANOVA with Dunnett's multiple comparison tests. n = 31 scramble, 30 shTomosyn, 29 WT rescue, 31 L412V rescue, and 31 Y502C rescue. (h) A reduction of GluR1 surface expression in dendritic segments in neurons co‐expressing shTomosyn‐L412V r ‐Tom‐RFP, compared to shTomosyn‐WT r ‐Tom‐RFP, was observed. ** p < 0.01 when compared to shTomosyn; ## p < 0.01, ### p < 0.001 when compared to shTomosyn‐L412V r ‐Tom‐RFP by one‐way ANOVA with Tukey's multiple comparisons test. n = 28 scramble, 21 shTomosyn, 22 WT rescue, 24 L412V rescue, 20 Y502C rescue

Article Snippet: The shRNA‐resistant tomosyn (wild‐type WT r ‐Tom‐GFP, L412V r ‐Tom‐GFP, and Y502C r ‐Tom‐GFP) constructs were made by mutating three nucleotides in the shTomosyn sequences with two PCR primers: Forward 5′‐AGTGGCTCTATGTGGGCACGGAACGCGGAAACATACACATTGTTA‐3′ and Reverse 5′‐TAACAATGTGTATGTTTCCGCGTTCCGTGCCCACATAGAGCCACT‐3′. shTomosyn‐WT r ‐Tom‐RFP, shTomosyn‐L412V r ‐Tom‐RFP, and shTomosyn‐Y502C r ‐Tom‐RFP were generated by inserting WT r ‐Tom, L412V r ‐Tom, or Y502C r ‐Tom into the shTomosyn vector. pcDNA3‐EGFP‐RhoA‐WT (Addgene, plasmid # 12965) and pcDNA3‐EGFP‐RhoA‐T19N (Addgene, plasmid # 12967) were gifts from Gary Bokoch (Subauste et al., ). pCI‐SEP‐GluR1 (Addgene, plasmid #24000) was a gift from Robert Malinow (Kopec, Li, Wei, Boehm, & Malinow, ). pTriEx‐RhoA FLARE.sc Biosensor WT (Addgene, plasmid # 12150) was a gift from Klaus Hahn (Pertz, Hodgson, Klemke, & Hahn, ). pCAGIG (IRES‐GFP; Addgene, plasmid # 11159) was a gift from Connie Cepko (Matsuda & Cepko, ). pRFP‐N1 was constructed by replacing GFP in the pEGFP‐N1 (Clontech, Catalog # 6085‐1) with RFP.

Techniques: Mutagenesis, Knockdown, Transfection, shRNA, Cell Culture, Construct, Comparison, Expressing